Details for DataSet_108
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2578872 | case | Homo sapiens | KLF4 | RNA_seq | GGGTGGGACGCGCCGGAACGA | 1 | chr9:107489104:- | 28923089 | GSE97816 | HEK293T | cell line | |
| GSM2578868 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 28923089 | GSE97816 | HEK293T | cell line | |
| GSM2578869 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 28923089 | GSE97816 | HEK293T | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
