Details for DataSet_124
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2805270 | case | Homo sapiens | Bach2 | RNA_seq | GAATGTAGCGATTGAGAGTGT | 1 | chr6:90296883:- | 29426832 | GSE87757 | 293T | cell line | 3 day |
| GSM2805273 | case | Homo sapiens | Bach2 | RNA_seq | GAATGTAGCGATTGAGAGTGT | 1 | chr6:90296883:- | 29426832 | GSE87757 | 293T | cell line | 3 day |
| GSM2805268 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 29426832 | GSE87757 | 293T | cell line | |
| GSM2805271 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 29426832 | GSE87757 | 293T | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
