Details for DataSet_126
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2932270 | case | Arabidopsis thaliana | FWA | RNA_seq | AAGCCCATACATCTTTCCGT | 1 | NC_003075.7:13038296:+ | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932271 | case | Arabidopsis thaliana | FWA | RNA_seq | AAGCCCATACATCTTTCCGT | 1 | NC_003075.7:13038296:+ | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932272 | control | Arabidopsis thaliana | NA | RNA_seq | NA | 0 | NA | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932273 | control | Arabidopsis thaliana | NA | RNA_seq | NA | 0 | NA | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932274 | control | Arabidopsis thaliana | NA | RNA_seq | NA | 0 | NA | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932275 | control | Arabidopsis thaliana | NA | RNA_seq | NA | 0 | NA | 29444862 | GSE109115 | Leaf | tissue | |
| GSM2932276 | control | Arabidopsis thaliana | NA | RNA_seq | NA | 0 | NA | 29444862 | GSE109115 | Leaf | tissue |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
