Details for DataSet_19
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM1838414 | case | Homo sapiens | HS2 | RNA_seq | aatatgtcacattctgtctc | 1 | chr11:5280570:+ | 26501517 | GSE71557 | K562 | cell line | |
| GSM1838415 | case | Homo sapiens | HS2 | RNA_seq | aatatgtcacattctgtctc | 1 | chr11:5280570:+ | 26501517 | GSE71557 | K562 | cell line | |
| GSM1838416 | case | Homo sapiens | HS2 | RNA_seq | aatatgtcacattctgtctc | 1 | chr11:5280570:+ | 26501517 | GSE71557 | K562 | cell line | |
| GSM1838420 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 26501517 | GSE71557 | K562 | cell line | |
| GSM1838421 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 26501517 | GSE71557 | K562 | cell line | |
| GSM1838422 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 26501517 | GSE71557 | K562 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
