Details for DataSet_220
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM3315875 | case | Rattus norvegicus | Bdnf | RNA_seq | AGAATACCAGAAAAGCGCAG | 1 | NC_086021.1:116619610:- | 30863790 | GSE117961 | Hippocampal neuron culture | tissue | |
| GSM3315876 | case | Rattus norvegicus | Bdnf | RNA_seq | AGAATACCAGAAAAGCGCAG | 1 | NC_086021.1:116619610:- | 30863790 | GSE117961 | Hippocampal neuron culture | tissue | |
| GSM3315877 | case | Rattus norvegicus | Bdnf | RNA_seq | AGAATACCAGAAAAGCGCAG | 1 | NC_086021.1:116619610:- | 30863790 | GSE117961 | Hippocampal neuron culture | tissue | |
| GSM3315872 | control | Rattus norvegicus | NA | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 30863790 | GSE117961 | Hippocampal neuron culture | tissue | |
| GSM3315873 | control | Rattus norvegicus | NA | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 30863790 | GSE117961 | Hippocampal neuron culture | tissue | |
| GSM3315874 | control | Rattus norvegicus | NA | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 30863790 | GSE117961 | Hippocampal neuron culture | tissue |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
