Details for DataSet_233
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM3897509 | case | Homo sapiens | TNFR1 | RNA_seq | CAGTGTTGCAACAGCGGGAC | 1 | chr12:6342081:+ | 31140325 | GSE132958 | intervertebral disc - nucleus pulposus | cell line | TNF-a treated |
| GSM3897510 | case | Homo sapiens | TNFR1 | RNA_seq | CAGTGTTGCAACAGCGGGAC | 1 | chr12:6342081:+ | 31140325 | GSE132958 | intervertebral disc - nucleus pulposus | cell line | TNF-a treated |
| GSM3897505 | control | Homo sapiens | TNFR1 | RNA_seq | CAGTGTTGCAACAGCGGGAC | 1 | chr12:6342081:+ | 31140325 | GSE132958 | intervertebral disc - nucleus pulposus | cell line | untreated |
| GSM3897506 | control | Homo sapiens | TNFR1 | RNA_seq | CAGTGTTGCAACAGCGGGAC | 1 | chr12:6342081:+ | 31140325 | GSE132958 | intervertebral disc - nucleus pulposus | cell line | untreated |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
