Details for DataSet_26
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2131629 | case | Homo sapiens | HBG1 | RNA_seq | CTTGACCAATAGCCTTGACA | 1 | chr11:5254882:- | 27214048 | GSE80611 | HEK293T | cell line | |
| GSM2131630 | case | Homo sapiens | HBG1 | RNA_seq | CTTGACCAATAGCCTTGACA | 1 | chr11:5254882:- | 27214048 | GSE80611 | HEK293T | cell line | |
| GSM2131633 | control | Homo sapiens | HBG1 | RNA_seq | CTTGACCAATAGCCTTGACA | 1 | chr11:5254882:- | 27214048 | GSE80611 | HEK293T | cell line | |
| GSM2131634 | control | Homo sapiens | HBG1 | RNA_seq | CTTGACCAATAGCCTTGACA | 1 | chr11:5254882:- | 27214048 | GSE80611 | HEK293T | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
