Details for DataSet_285
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM3854149 | case | Homo sapiens | HS2 | RNA_seq | GGCCCTGTAAGCATCCTGCTG | 1 | chr11:5280667:+ | 31980609 | GSE132216 | K562 | cell line | |
| GSM3854150 | case | Homo sapiens | HS2 | RNA_seq | GGCCCTGTAAGCATCCTGCTG | 1 | chr11:5280667:+ | 31980609 | GSE132216 | K562 | cell line | |
| GSM3854151 | control | Homo sapiens | Gal4 | RNA_seq | GAACGACTAGTTAGGCGTGTA | 1 | NA | 31980609 | GSE132216 | K562 | cell line | |
| GSM3854152 | control | Homo sapiens | Gal4 | RNA_seq | GAACGACTAGTTAGGCGTGTA | 1 | NA | 31980609 | GSE132216 | K562 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
