Details for DataSet_330


Sample info of the DataSet

Sample_accession Sample_group Organism Target_gene Data_type sgRNA sgRNA_Number_perVector sgRNA_coordinate PubMed Data_source Cell_type Sample_Type Notes
GSM2152031caseHomo sapiensHBE1RNA_seqTGTCACTGTCACCACCTTTA1chr11:5270319:-28416141GSE81412K562cell line
GSM2152032controlHomo sapiensNARNA_seqNA0NA28416141GSE81412K562cell line

Gene expression profile

       

Scatter diagram of differential expression

Heatmap of unsupervised hierarchical clustering

Heatmap image


Function Enrichment Analysis of differentially expressed genes & Gene Set Enrichment Analysis (GSEA) of all expressed genes