Details for DataSet_351
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2326200 | case | Homo sapiens | GATA1 | RNA_seq | GGGTAGGGGCAGCAGGCCCA | 1 | chrX:48786686:- | 27708057 | GSE87257 | K562 | cell line | |
| GSM2326201 | case | Homo sapiens | GATA1 | RNA_seq | GGGTAGGGGCAGCAGGCCCA | 1 | chrX:48786686:- | 27708057 | GSE87257 | K562 | cell line | |
| GSM2326202 | case | Homo sapiens | GATA1 | RNA_seq | GGGTAGGGGCAGCAGGCCCA | 1 | chrX:48786686:- | 27708057 | GSE87257 | K562 | cell line | |
| GSM2326206 | control | Homo sapiens | NA | RNA_seq | GATCGCGAGGACCCGTTCCGCC | 1 | NA | 27708057 | GSE87257 | K562 | cell line | |
| GSM2326207 | control | Homo sapiens | NA | RNA_seq | GATCGCGAGGACCCGTTCCGCC | 1 | NA | 27708057 | GSE87257 | K562 | cell line | |
| GSM2326208 | control | Homo sapiens | NA | RNA_seq | GATCGCGAGGACCCGTTCCGCC | 1 | NA | 27708057 | GSE87257 | K562 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
