Details for DataSet_403
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4240446 | case | Homo sapiens | MYC | RNA_seq | GGGGCGCGCGTTCAGAGCGT | 1 | chr8:127735559:- | 33741908 | GSE142809 | 22Rv1 | cell line | |
| GSM4240448 | case | Homo sapiens | MYC | RNA_seq | GGGGCGCGCGTTCAGAGCGT | 1 | chr8:127735559:- | 33741908 | GSE142809 | 22Rv1 | cell line | |
| GSM4240439 | control | Homo sapiens | LacZ | RNA_seq | CCCGAATCTCTATCGTGCGG | 1 | NA | 33741908 | GSE142809 | 22Rv1 | cell line | |
| GSM4240440 | control | Homo sapiens | Luc | RNA_seq | AATTGTCTTGTCCCTATCGA | 1 | NA | 33741908 | GSE142809 | 22Rv1 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
