Details for DataSet_407
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4320346 | case | Homo sapiens | TGFB1;B9D2 | RNA_seq | ggtggctggcgtgacgcgga | 1 | chr19:41363840:- | 32500120 | GSE145530 | H441 | cell line | |
| GSM4320347 | case | Homo sapiens | TGFB1;B9D2 | RNA_seq | ggtggctggcgtgacgcgga | 1 | chr19:41363840:- | 32500120 | GSE145530 | H441 | cell line | |
| GSM4320348 | case | Homo sapiens | TGFB1;B9D2 | RNA_seq | ggtggctggcgtgacgcgga | 1 | chr19:41363840:- | 32500120 | GSE145530 | H441 | cell line | |
| GSM4320349 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 32500120 | GSE145530 | H441 | cell line | |
| GSM4320350 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 32500120 | GSE145530 | H441 | cell line | |
| GSM4320351 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 32500120 | GSE145530 | H441 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
