Details for DataSet_408
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4490288 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490289 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490290 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490291 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490292 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490271 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490272 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490273 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490274 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490275 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
