Details for DataSet_409
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4490293 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490294 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490295 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490296 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490297 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490298 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490276 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490277 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490278 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490279 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490280 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
