Details for DataSet_410
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4490299 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490300 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490301 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490302 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490303 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490304 | case | Mus musculus | Pparg2 | RNA_seq | GAATAAACACAGAAAGAATC | 1 | chr6:115398896:- | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490282 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490283 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490284 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490285 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490286 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
| GSM4490287 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 4 differentiation |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
