Details for DataSet_411
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4490305 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490306 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490307 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490308 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490309 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490310 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490271 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490272 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490273 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490274 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
| GSM4490275 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 0 differentiation |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
