Details for DataSet_412
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM4490311 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490312 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490313 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490314 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490315 | case | Mus musculus | Pparg2;Ybx1 | RNA_seq | GAATAAACACAGAAAGAATC,GCCTCCGCCGCCATAGAGAC | 2 | chr6:115398896:-,chr4:119151886:+ | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490276 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490277 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490278 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490279 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490280 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
| GSM4490281 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 33285300 | GSE149083 | Mesenchymal C3H/10T1/2 | cell line | day 2 differentiation |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
