Details for DataSet_42
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2256088 | case | Homo sapiens | CTC-428G20.6 | RNA_seq | GGCACTGACTGGTTTCAAGT | 10 | chr5:115262578:- | 27980086 | GSE85011 | HeLa | cell line | |
| GSM2256172 | control | Homo sapiens | NA | RNA_seq | GAACGACTAGTTAGGCGTGTA | 10 | NA | 27980086 | GSE85011 | HeLa | cell line | |
| GSM2256173 | control | Homo sapiens | NA | RNA_seq | GAACGACTAGTTAGGCGTGTA | 10 | NA | 27980086 | GSE85011 | HeLa | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
