Details for DataSet_423
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5009739 | case | Homo sapiens | IL1RN | RNA_seq | TCCCAATGCCTGGAAGAGTGCC | 1 | chr2:113117563:+ | 33751124 | GSE164452 | HEK293T | cell line | |
| GSM5009740 | case | Homo sapiens | IL1RN | RNA_seq | TCCCAATGCCTGGAAGAGTGCC | 1 | chr2:113117563:+ | 33751124 | GSE164452 | HEK293T | cell line | |
| GSM5106950 | case | Homo sapiens | IL1RN | RNA_seq | TCCCAATGCCTGGAAGAGTGCC | 1 | chr2:113117563:+ | 33751124 | GSE164452 | HEK293T | cell line | |
| GSM5009735 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 33751124 | GSE164452 | HEK293T | cell line | |
| GSM5009737 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 33751124 | GSE164452 | HEK293T | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
