Details for DataSet_433
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5387249 | case | Homo sapiens | KIF4A | RNA_seq | GTACGCACCTGAGGCTCTCC,GGGCCCAGGGAGAACGGGGA | 2 | chrX:70290567:-,chr21:43702265:+ | 34326322 | GSE178330 | LNCaP | cell line | |
| GSM5387250 | case | Homo sapiens | KIF4A | RNA_seq | GTACGCACCTGAGGCTCTCC,GGGCCCAGGGAGAACGGGGA | 2 | chrX:70290567:-,chr21:43702265:+ | 34326322 | GSE178330 | LNCaP | cell line | |
| GSM5387245 | control | Homo sapiens | NA | RNA_seq | GAACGACTAGTTAGGCGTGTA | 1 | NA | 34326322 | GSE178330 | LNCaP | cell line | |
| GSM5387246 | control | Homo sapiens | NA | RNA_seq | GAACGACTAGTTAGGCGTGTA | 1 | NA | 34326322 | GSE178330 | LNCaP | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
