Details for DataSet_439
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5434639 | case | Mus musculus | Ifng | RNA_seq | GTTACTTTGCATTACAGCTA,ATCCCGAGGAGCCTTCGATC | 2 | chr10:118276805:-,chr10:118276898:+ | 35304449 | GSE179814 | LLC | cell line | p53+ |
| GSM5434640 | case | Mus musculus | Ifng | RNA_seq | GTTACTTTGCATTACAGCTA,ATCCCGAGGAGCCTTCGATC | 2 | chr10:118276805:-,chr10:118276898:+ | 35304449 | GSE179814 | LLC | cell line | p53+ |
| GSM5434641 | case | Mus musculus | Ifng | RNA_seq | GTTACTTTGCATTACAGCTA,ATCCCGAGGAGCCTTCGATC | 2 | chr10:118276805:-,chr10:118276898:+ | 35304449 | GSE179814 | LLC | cell line | p53+ |
| GSM5434636 | control | Mus musculus | NA | RNA_seq | GTCAGATCCGCTAGCGCTAC | 1 | NA | 35304449 | GSE179814 | LLC | cell line | p53+ |
| GSM5434637 | control | Mus musculus | NA | RNA_seq | GTCAGATCCGCTAGCGCTAC | 1 | NA | 35304449 | GSE179814 | LLC | cell line | p53+ |
| GSM5434638 | control | Mus musculus | NA | RNA_seq | GTCAGATCCGCTAGCGCTAC | 1 | NA | 35304449 | GSE179814 | LLC | cell line | p53+ |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
