Details for DataSet_442
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5525369 | case | Homo sapiens | ZNF558 | RNA_seq | AGTCGGCGCTTTTGGCCCCG | 1 | chr19:8832227:- | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525372 | case | Homo sapiens | ZNF558 | RNA_seq | AGTCGGCGCTTTTGGCCCCG | 1 | chr19:8832227:- | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525375 | case | Homo sapiens | ZNF558 | RNA_seq | AGTCGGCGCTTTTGGCCCCG | 1 | chr19:8832227:- | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525378 | case | Homo sapiens | ZNF558 | RNA_seq | AGTCGGCGCTTTTGGCCCCG | 1 | chr19:8832227:- | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525367 | control | Homo sapiens | LacZ | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525370 | control | Homo sapiens | LacZ | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525373 | control | Homo sapiens | LacZ | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line | |
| GSM5525376 | control | Homo sapiens | LacZ | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 34624206 | GSE182224 | human neural forebrain progenitor cells | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
