Details for DataSet_448
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5578196 | case | Homo sapiens | ZNF558 | RNA_seq | GCCAAAAGCGCCGACTCGCG | 1 | chr19:8832231:+ | 34624206 | GSE182224 | human cerebral organoids | organoid line | 63 days |
| GSM5578200 | control | Homo sapiens | LacZ | RNA_seq | TGCGAATACGCCCACGCGAT | 1 | NA | 34624206 | GSE182224 | human cerebral organoids | organoid line | 63 days |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
