Details for DataSet_455
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5708972 | case | Homo sapiens | SOX2 | RNA_seq | GACAGCCCCCGTCACATGGA | 1 | chr3:181711907:+ | 36121125 | GSE189884 | HDBRN13393 | organoid line | |
| GSM5708969 | control | Homo sapiens | NA | RNA_seq | NA | 1 | NA | 36121125 | GSE189884 | HDBRN13393 | organoid line | |
| GSM5708970 | control | Homo sapiens | NA | RNA_seq | NA | 1 | NA | 36121125 | GSE189884 | HDBRN13393 | organoid line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
