Details for DataSet_461
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM5847950 | case | Homo sapiens | SE60 | RNA_seq | TTACACAGAAGGCCGTTCAC,ACCTATAAGAACGGAGTGCT | 2 | chr20:53738513:+,chr20:53748258:- | 35869079 | GSE195675 | OVCAR3 | cell line | |
| GSM5847951 | case | Homo sapiens | SE60 | RNA_seq | TTACACAGAAGGCCGTTCAC,ACCTATAAGAACGGAGTGCT | 2 | chr20:53738513:+,chr20:53748258:- | 35869079 | GSE195675 | OVCAR3 | cell line | |
| GSM5847948 | control | Homo sapiens | NA | RNA_seq | NA | 2 | NA | 35869079 | GSE195675 | OVCAR3 | cell line | |
| GSM5847949 | control | Homo sapiens | NA | RNA_seq | NA | 2 | NA | 35869079 | GSE195675 | OVCAR3 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
