Details for DataSet_505
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM6427496 | case | Homo sapiens | ZEB1 | RNA_seq | GGGCGGTTTGCGGCAACCGT,AGAGGCTCTCGCTCTACGGC,CACCTGGTTTACGACACTCC,AGCATTTAGACACAAGCGAG | 4 | chr10:31319209:+,chr10:31319025:-,chr10:31319067:-,chr10:31319117:- | 37217832 | GSE210277 | SUM159 | cell line | |
| GSM6427497 | case | Homo sapiens | ZEB1 | RNA_seq | GGGCGGTTTGCGGCAACCGT,AGAGGCTCTCGCTCTACGGC,CACCTGGTTTACGACACTCC,AGCATTTAGACACAAGCGAG | 4 | chr10:31319209:+,chr10:31319025:-,chr10:31319067:-,chr10:31319117:- | 37217832 | GSE210277 | SUM159 | cell line | |
| GSM6427498 | case | Homo sapiens | ZEB1 | RNA_seq | GGGCGGTTTGCGGCAACCGT,AGAGGCTCTCGCTCTACGGC,CACCTGGTTTACGACACTCC,AGCATTTAGACACAAGCGAG | 4 | chr10:31319209:+,chr10:31319025:-,chr10:31319067:-,chr10:31319117:- | 37217832 | GSE210277 | SUM159 | cell line | |
| GSM6427490 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | SUM159 | cell line | |
| GSM6427491 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | SUM159 | cell line | |
| GSM6427492 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | SUM159 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
