Details for DataSet_506
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM6427505 | case | Homo sapiens | ZEB1 | RNA_seq | AGCATTTAGACACAAGCGAG | 1 | chr10:31319209:+ | 37217832 | GSE210277 | MDA-MB-231 | cell line | |
| GSM6427506 | case | Homo sapiens | ZEB1 | RNA_seq | AGCATTTAGACACAAGCGAG | 1 | chr10:31319209:+ | 37217832 | GSE210277 | MDA-MB-231 | cell line | |
| GSM6427507 | case | Homo sapiens | ZEB1 | RNA_seq | AGCATTTAGACACAAGCGAG | 1 | chr10:31319209:+ | 37217832 | GSE210277 | MDA-MB-231 | cell line | |
| GSM6427502 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | MDA-MB-231 | cell line | |
| GSM6427503 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | MDA-MB-231 | cell line | |
| GSM6427504 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 37217832 | GSE210277 | MDA-MB-231 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
