Details for DataSet_517
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM7047817 | case | Homo sapiens | OBSCN-AS1 | RNA_seq | GGGGCAAGGAGGCACCGAGA | 1 | chr1:228213764:+ | 36877839 | GSE225387 | MDA-MB-231 | cell line | |
| GSM7047815 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 36877839 | GSE225387 | MDA-MB-231 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
