Details for DataSet_598
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM7114485 | case | Homo sapiens | chr17-46764999 | RNA_seq | aaggccctcagctagaggtg,CATTATCAAGCTATTTGGTG | 2 | chr17:46764869:-,chr17:46765019:- | 38232730 | GSE228121 | XCL4 | cell line | |
| GSM7114496 | case | Homo sapiens | chr17-46764999 | RNA_seq | aaggccctcagctagaggtg,CATTATCAAGCTATTTGGTG | 2 | chr17:46764869:-,chr17:46765019:- | 38232730 | GSE228121 | XCL4 | cell line | |
| GSM7114331 | control | Homo sapiens | GFP | RNA_seq | NA | 1 | NA | 38232730 | GSE228121 | XCL4 | cell line | |
| GSM7114360 | control | Homo sapiens | GFP | RNA_seq | NA | 1 | NA | 38232730 | GSE228121 | XCL4 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
