Details for DataSet_647
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM7122386 | case | Homo sapiens | USP7 | RNA_seq | GCTCCTCGGCGTCGTCGTCG,GAGCGAGGAGAGCAAGCGGG | 2 | chr16:87492594:+,chr16:8963940:+ | 38608704 | GSE228464 | K562 | cell line | |
| GSM7122387 | case | Homo sapiens | USP7 | RNA_seq | GCTCCTCGGCGTCGTCGTCG,GAGCGAGGAGAGCAAGCGGG | 2 | chr16:87492594:+,chr16:8963940:+ | 38608704 | GSE228464 | K562 | cell line | |
| GSM7122384 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 38608704 | GSE228464 | K562 | cell line | |
| GSM7122385 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 38608704 | GSE228464 | K562 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
