Details for DataSet_674
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM7882714 | case | Homo sapiens | MYC | RNA_seq | TAATTCCAGCGAGAGGCAG | 1 | chr8:127736243:+ | 39033128 | GSE228247 | H2170 | cell line | |
| GSM7882715 | case | Homo sapiens | MYC | RNA_seq | CAGCGCAGCTCTGCTCGCC | 1 | chr8:127736300:- | 39033128 | GSE228247 | H2170 | cell line | |
| GSM7882712 | control | Homo sapiens | NA | RNA_seq | ATCGTTTCCGCTTAACGGCG | 1 | NA | 39033128 | GSE228247 | H2170 | cell line | |
| GSM7882713 | control | Homo sapiens | NA | RNA_seq | CTGAGTGAAAAATAAAAGTT | 1 | chr21:14374285:+ | 39033128 | GSE228247 | H2170 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
