Details for DataSet_678
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM7892649 | case | Homo sapiens | MYB | RNA_seq | AAGATCTCCTGCTACTTGTG,GTAGAGCAACGCCTAGACAA,AATGCTTAGAACCTACAGAG | 3 | chr6:135267061:+,chr6:135267113:-,chr6:135267466:- | 38720882 | GSE247538 | YCC10 | cell line | |
| GSM7892647 | control | Homo sapiens | NA | RNA_seq | GGCCGTAATACAGGTATGTA | 1 | NA | 38720882 | GSE247538 | YCC10 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
