Details for DataSet_684

Sample info of the DataSet

Sample_accession Sample_group Organism Target_gene Data_type sgRNA sgRNA_Number_perVector sgRNA_coordinate PubMed Data_source Cell_type Sample_Type Notes
GSM8085151caseMus musculusNID2RNA_seqTGCGGACCAGAGGTCCAAGT1chr14:19801317:+38959305GSE256072KPC CAF C500cell line
GSM8085149controlMus musculusGFP-1RNA_seqGACCAGGATGGGCACCACCC1chr3:53484401:+38959305GSE256072KPC CAF C500cell line

Gene expression profile

       

Scatter diagram of differential expression

Heatmap of unsupervised hierarchical clustering

Heatmap image


Function Enrichment Analysis of differentially expressed genes & Gene Set Enrichment Analysis (GSEA) of all expressed genes