Details for DataSet_705
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SAMEA5097506 | case | Mus musculus | Mycn | RNA_seq | GGGAGAAAGGCAGAGGCAAG,CTGTGGCGCAGACGAGGGGG,GGCTGCGCTTTGAAGCTCGG | 3 | chr12:12991935:+,chr12:12991914:+,chr12:12991838:+ | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line | |
| SAMEA5097507 | case | Mus musculus | Mycn | RNA_seq | GGGAGAAAGGCAGAGGCAAG,CTGTGGCGCAGACGAGGGGG,GGCTGCGCTTTGAAGCTCGG | 3 | chr12:12991935:+,chr12:12991914:+,chr12:12991838:+ | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line | |
| SAMEA5097508 | case | Mus musculus | Mycn | RNA_seq | GGGAGAAAGGCAGAGGCAAG,CTGTGGCGCAGACGAGGGGG,GGCTGCGCTTTGAAGCTCGG | 3 | chr12:12991935:+,chr12:12991914:+,chr12:12991838:+ | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line | |
| SAMEA5097497 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line | |
| SAMEA5097498 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line | |
| SAMEA5097499 | control | Mus musculus | NA | RNA_seq | NA | 0 | NA | 31375684 | E-MTAB-7411 | small cell lung carcinoma | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
