Details for DataSet_86
Sample info of the DataSet
| Sample_accession | Sample_group | Organism | Target_gene | Data_type | sgRNA | sgRNA_Number_perVector | sgRNA_coordinate | PubMed | Data_source | Cell_type | Sample_Type | Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GSM2152027 | case | Homo sapiens | HSBP1 | RNA_seq | ACGGCGCGCTGCGTGAGGGG | 1 | chr16:83807807:+ | 28416141 | GSE81412 | K562 | cell line | |
| GSM2152032 | control | Homo sapiens | NA | RNA_seq | NA | 0 | NA | 28416141 | GSE81412 | K562 | cell line |
Gene expression profile
Scatter diagram of differential expression
Heatmap of unsupervised hierarchical clustering
